1. What is your opinion on stem cell research and the use of stem cells in bioengineering? Find an article that supports your opinion. Post the URL of the site where you found the article, along with a brief summary of it.
2. Do you feel the amount of money spent on stem cell research is appropr...
The bonding properties of water give it certain characteristics: surface tension, capillary action, universal solvent, high specific heat, and a high heat of vaporization. Indicate three reasons why you believe these properties are important to organisms that live underwater. In your own words, expl...
This assignment focuses on the methodology of peptide mass finger printing (PMF) and use of mass spectrum analysis software. The lecture notes provide a good foundation for this but you will have to carry out additional personal research to effectively answer the questions. The learning objective of...
Answer the following questions about DNA microarrays and gene expression analysis
a. Why aren't all genes expressed all the time?
b. What is the advantage of using DNA arrays vs. one gene at a time analysis?
c. What is the significance of co-regulated genes?
d. What is the significance of a cond...
Discuss lambda phage as an experimental system. How has it been used in biotechnology? Explain how it is used as a vector for the cloning of recombinant DNA. Why is it important to know about restriction enzyme sites in phage lambda DNA? How would a scientist use a restriction site map for lambda?
An x-ray exam has been performed on a female who later determined she was pregnant at the time of the x-ray exposure. Discuss the factors that affect her embryo's response to irradiation. Explain the possible principal effects of irradiation to her fetus.
Design a graph/table showing specific e...
You must answer the questions. 600 words each question. . Use diagrams to illustrate with the explanation? . The questions are all essay- type. read them carefully and make sure you answer the question posed.
1. Discuss the structure and function of integrins using diagrams to illustrate your an...
To do molecular biology studies of DNA, one must develop methods to extract it. The extraction of DNA can be very complicated because of the structural and chemical complexity of cells. Eukaryotic cells are composed of many different organelles that are suspended in a complex aqueous matrix of solu...
Could cell, tissue, or genetic engineering allow humans to use chloroplasts this way? Describe 1 or 2 factors that would need to be considered for chloroplasts to function in an animal or a human.
Choose 1 organelle, and use an analogy to explain its function. For example, explain how a chloroplast is like a solar panel, or how a mitochondrion is like a furnace. Try to think of original analogies for other organelles or cell structures such as golgi, lysosomes, the cell wall, cell membrane, e...
For each of the SLP assignments, you will be provided with a hypothetical experimental scenario or data. These assignments are more opened-ended than the case assignments. You will speculate about possible explanations and the ways they might be tested, but be sure to that your hypotheses are ground...
1) Why is the Hardy-Weinberg law useful?
2) Define genetic drift.
2) What factors influence the mutation rate of a population?
3) Briefly explain the difference between stabilizing selection, directional selection, and disruptive selection.
4) Why are layers of sedimentary rocks particul...
You perform DNA microarray experiments on cancer cells at different time points
(0, 6, and 12 hours) following the addition of a novel anti-cancer drug. You obtain the following
normalized and scaled microarray data for the genes Myc, p53, and Ras.
Gene Name 0 hr 6 hr 12 hr...
Using the document attached, use the Needleman-Wunsch dynamic programming method to align the following pair of sequences.
(see attached)
Use the unitary scoring method to score the initial alignment matrix. Write the appropriate score into each square in the matrix below.
(see attached)
U...
Please see the attachment for Table 1.
Dissolved oxygen is oxygen that is trapped in a fluid, such as water. Since virtually every living organism requires oxygen to survive, it is a necessary component of water systems such as streams, lakes and rivers in order to support aquatic life. The disso...
Hi, I need assistance with the following biology questions:
1. Distinguish between tonic and phasic receptors? Which type is likely to be a fast-adapting receptor? Which type is likely to be a slow-adapting receptor?
2.Why are the ependymal cells so important in the formation and circulation of ...
Stem Cell Research
Write two paragraphs or less which describe your current position on stem cell research. In your paper discuss why you hold that view. Describe the circumstances, if any, under which you might reconsider your position.
Conduct your own search on President Obama's views of stem c...
What is genetic fingerprinting?
Should all children be genetically finger printed at birth? If so, who should control the information obtained and who should have access to the information? What are the advantages, disadvantages, and potential problems associated with this proposal?
Explain how this technique was and how it was applied to solve a biological question.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3312548/?tool=pubmed
Besides labeling and identifying cells by their surface markers, what ate 2 other applications of flow cytometer techniques.
A 267 base pair region encompassing nt 1,691 of FV was PCR-amplified using a primer pair originally described by Bertina and collegues with a 5'sense primer of sequence 5' TGCCCAGTGTTAAACAAGACCA 3' (primer PR-6967, nt 1,581 to 1,602, exon 10) and a 3' antisense primer of sequence 5' TGTTATCACACTGGTG...
2. The inner membranes of cyanobacteria are very similar to those of the thylakoid membrane of chloroplasts. This similarity supports the hypothesis that chloroplasts evolved from symbiotic cyanobacteria. Which other organelles may have originated in the same way? Explain, providing evidence for you...
A.
When the concentration of sugar is doubled, assuming there is enough yeast, what happens to the time it takes for the solution to change from blue to yellow? â?¨
1. halved
2. â?¨stays the same
3. â?¨doubles
4. â?¨triples
B.
A test tube is setup with some yeast, sugar solution ...
We now understand that mutations that cause the inhibition of apoptosis are found in tumors. Because proliferation itself is not induced by the inhibition of apoptosis, explain how this inhibition might contribute to tumor formation.
The file called "genetics2" contains the original assignment with the background information and questions to be solved. Files Unit+4+notes and Unit+5+notes contain more extensive background information, which is not directly related to the assignment. The attached file 407374Instrucations contains ...